Products > Genes > Signaling > Signal Transduction(S)

Rhesus WSX-1/IL-27R Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90129-ACG)

Overview

Product nameRhesus WSX-1/IL-27R Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.CG90129-ACG
NCBI RefSeq1911 bp
TypeExpression-Ready ORF Clones
The interleukin-27 receptor is a type I cytokine receptor for interleukin-27. It is a heterodimer composed of the interleukin 27 receptor, alpha subunit and glycoprotein 130. WSX-1/IL-27R, a class I cytokine receptor that is homologous to the β2 chain of the IL-12R in both sequence and structure, is highly expressed by resting/naive CD4+ T cells and CD8+ T cells. WSX-1/IL-27R belongs to the IL-6/IL-12 family of cytokines and induced proliferation of naive CD4(+) T cells and the generation of a Th1-type adaptive immune response. WSX-1/IL-27R functions as a receptor for IL27. IL-27 not only contributes to the development of an adaptive immune response throµgh its action on CD4(+) T cells, it also directly acts on cells of the innate immune system. WSX-1/IL-27R requires IL6ST/gp130 to mediate signal transduction in response to IL27. This signaling system acts throµgh STAT3 and STAT1. It is involved in the regulation of Th1-type immune responses. IL-27R also appears to be involved in innate defense mechanisms. IL27RA is essential for transcriptional activation of STAT1 and for aµgmenting the induction of T-bet expression during initiation of Th1 cell differentiation.
Molecule nameIL27Ra
RefSeq ORF size1911 bp
cDNA descriptionRhesus WSX-1/IL-27R Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90129-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
VectorpCMV3-C-GFPSpark
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90129-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order