Products > Genes > Signaling > Signal Transduction(S)

Rhesus TNFSF13 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90095-ACG)

Overview

Product nameRhesus TNFSF13 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.CG90095-ACG
NCBI RefSeq753 bp
TypeExpression-Ready ORF Clones
TNFSF13 is a member of the tumor necrosis factor (TNF) ligand family. It is a ligand for TNFRSF17/BCMA. TNFSF13 is lowly expressed in normal tissues, but is elevated in several types of tumors and transformed cell lines. It is mportant for B cell development. TNFSF13 may also play a role in T-independent type II antigen responses and T cell survival, and induce proliferation/survival of non lymphoid cells. It exists as a functional homotrimer. It can bind to two cell surface receptors, BCMA and TACI, which it shares with BAFF to exert downstream T- and B-cell regulatory effects. TNFSF13 also has been demonstrated to bind to proteoglycans on the cell surface.

Molecule nameTNFSF13
RefSeq ORF size753 bp
cDNA descriptionRhesus TNFSF13 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90095-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
VectorpCMV3-C-GFPSpark
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90095-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order