Products > Genes > Signaling > Signal Transduction(S)

Rhesus CDH13 / Cadherin-13 / H Cadherin Gene ORF cDNA clone expression plasmid (CG90141-UT)

Overview

Product nameRhesus CDH13 / Cadherin-13 / H Cadherin Gene ORF cDNA clone expression plasmid
Catalog No.CG90141-UT
NCBI RefSeq2142 bp
TypeExpression-Ready ORF Clones
CDH13, also known as cadherin-13 and H Cadherin, is a member of the cadherin superfamily. CDH13 acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. CDH13 is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. CDH13 gene is hypermethylated in many types of cancer.

Molecule nameCDH13
RefSeq ORF size2142 bp
cDNA descriptionRhesus CDH13 / Cadherin-13 / H Cadherin Gene ORF cDNA clone expression plasmid (CG90141-UT) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-untagged Vector) to other plasmid vectors.
VectorpCMV3-untagged
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliAmpicillin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90141-UT below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order