Products > Genes > Epigenetics > Apoptosis(E)

Human PPM1B Gene ORF cDNA clone expression plasmid, C-His tag (HG12224-CH)

Overview

Product nameHuman PPM1B Gene ORF cDNA clone expression plasmid, C-His tag
Catalog No.HG12224-CH
NCBI RefSeq579 bp
TypeExpression-Ready ORF Clones
Molecule namePPM1B
RefSeq ORF size579 bp
cDNA descriptionHuman PPM1B Gene ORF cDNA clone expression plasmid, C-His tag (HG12224-CH) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-His Vector) to other plasmid vectors.
SynonymPP2C-beta, PP2C-beta-X, PP2CB, PP2CBETA, PPC2BETAX
VectorpCMV3-C-His
Tag SsequenceHis Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about HG12224-CH below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order