Products > Genes > Cell Biology > Apoptosis(C)

Human IL-4I1 Gene ORF cDNA clone expression plasmid (HG11950-UT)

Images(1)

GFP Gene Plasmid Map

Overview

Product nameHuman IL-4I1 Gene ORF cDNA clone expression plasmid
Catalog No.HG11950-UT
NCBI RefSeq1770 bp
TypeExpression-Ready ORF Clones
Molecule nameIL4I1
RefSeq ORF size1770 bp
cDNA descriptionHuman IL-4I1 Gene ORF cDNA clone expression plasmid (HG11950-UT) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-untagged Vector) to other plasmid vectors.
SynonymFIG1, LAAO, LAO
VectorpCMV3-untagged
PlasimidpCMV3-IL4I1
Restriction siteKpnI + XbaI (6.1kb + 1.77kb)
Sequence descriptionIdentical with the Gene Bank Ref. ID sequence.
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliAmpicillin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

GFP Gene Plasmid Map

Inquire About This Product

Submit your question about HG11950-UT below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order