Products > Genes > Other

Green fluorescent protein / GFP Gene ORF cDNA clone expression plasmid (AG13105-UT)

Images(1)

GFP Gene Plasmid Map

Overview

Product nameGreen fluorescent protein / GFP Gene ORF cDNA clone expression plasmid
Catalog No.AG13105-UT
NCBI RefSeq717 bp
TypeExpression-Ready ORF Clones
Molecule nameGFP
RefSeq ORF size717 bp
cDNA descriptionGreen fluorescent protein / GFP Gene ORF cDNA clone expression plasmid (AG13105-UT) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-untagged Vector) to other plasmid vectors.
VectorpCMV3-untagged
PlasimidpCMV3-GFP
Restriction siteKpnI + XbaI (6.1kb + 0.72kb)
Sequence descriptionA number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAX31732.1.
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliAmpicillin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

GFP Gene Plasmid Map

Inquire About This Product

Submit your question about AG13105-UT below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order