Products > Genes > Signaling > Signal Transduction(S)

Rhesus aFGF/FGF1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90062-ACG)

Overview

Product nameRhesus aFGF/FGF1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.CG90062-ACG
NCBI RefSeq468 bp
TypeExpression-Ready ORF Clones
aFGF, also known as FGF1 and HBGF-1, is a member of the fibroblast growth factor family. The biological activity of aFGF protein is exerted throµgh binding to four high affinity cell surface receptors (FGFR1–4), which results in receptor dimerization and transphosphorylation in the tyrosine kinase domain. aFGF protein shows a wide range of endocrine-like activities. As a multiple function growth factor, this protein is involved in embryo development and tissue repair. Additionally, this protein is considered to function in several important physiological and pathological processes, such as embryonic development, morphogenesis, angiogenesis, wound healing and atheromatosis, carcinogenesis, development, and invasion of cancer.

References

Molecule nameFGF1
RefSeq ORF size468 bp
cDNA descriptionRhesus aFGF/FGF1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90062-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
VectorpCMV3-C-GFPSpark
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90062-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order