Products > Genes > Signaling > Signal Transduction(S)

Rhesus TGF-beta 3/TGFB3 Gene ORF cDNA clone expression plasmid, C-HA tag (CG90037-CY)

Overview

Product nameRhesus TGF-beta 3/TGFB3 Gene ORF cDNA clone expression plasmid, C-HA tag
Catalog No.CG90037-CY
NCBI RefSeq1239 bp
TypeExpression-Ready ORF Clones
Molecule nameTGFB3
RefSeq ORF size1239 bp
cDNA descriptionRhesus TGF-beta 3/TGFB3 Gene ORF cDNA clone expression plasmid, C-HA tag (CG90037-CY) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-HA Vector) to other plasmid vectors.
VectorpCMV3-C-HA
Tag SsequenceHA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90037-CY below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order