Products > Genes > Cancer > Cancer immunology

Rhesus IL4/IL-4/Interleukin-4 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90281-ACG)

Overview

Product nameRhesus IL4/IL-4/Interleukin-4 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.CG90281-ACG
NCBI RefSeq462 bp
TypeExpression-Ready ORF Clones
Interleukin-4, also known as IL4, is a secreted protein which belongs to the IL-4 / IL-13 family. Interleukin-4 / IL4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation. It enhances both secretion and cell surface expression of IgE and IgG1. Interleukin-4 / IL4 also regulates the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes. Interleukin-4 is essential for the switching of B cells to IgE antibody production and for the maturation of T helper (Th) cells toward the Th2 phenotype. It participates in at least several B-cell activation processes as well as of other cell types. However, studies show that double mutant (Q116D, Y119D) of the murine IL4 protein (QY), both glutamine 116 and tyrosine 119, which binds to the IL4 receptor alpha, completely inhibites in a dose-dependent manner the IL4-induced proliferation of lipopolysaccharide-stimulated murine splenic B-cells, of the murine T cell line CTLL-2, and of the murine pre-B-cell line BA/F3. QY also inhibited the IL4-stimulated up-regulation of CD23 expression by lipopolysaccharide-stimulated murine splenic B-cells and abolished tyrosine phosphorylation of the transcription factor Stat6 and the tyrosine kinase Jak3 in IL4-stimulated BA/F3 cells.

Molecule nameIL4
RefSeq ORF size462 bp
cDNA descriptionRhesus IL4/IL-4/Interleukin-4 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90281-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
VectorpCMV3-C-GFPSpark
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90281-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order