Products > Genes > Signaling > Signal Transduction(S)

Rhesus FGF10 / KGF2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90087-ACG)

Overview

Product nameRhesus FGF10 / KGF2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.CG90087-ACG
NCBI RefSeq627 bp
TypeExpression-Ready ORF Clones
Fibroblast growth factor 10 (FGF10) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF10 exhibits mitogenic activity for keratinizing epidermal cells, but essentially no activity for fibroblasts, which is similar to the biological activity of FGF7. FGF10 plays an important role in the regulation of embryonic development, cell proliferation and cell differentiation. FGF10 is required for normal branching morphogenesis. It may play a role in wound healing. Defects in FGF10 are the cause of autosomal dominant aplasia of lacrimal and salivary glands (ALSG). ALSG has variable expressivity, and affected individuals may have aplasia or hypoplasia of the lacrimal, parotid, submandibular and sublingual glands and absence of the lacrimal puncta. The disorder is characterized by irritable eyes, recurrent eye infections, epiphora (constant tearing) and xerostomia (dryness of the mouth), which increases the risk of dental erosion, dental caries, periodontal disease and oral infections.
Molecule nameFGF10
RefSeq ORF size627 bp
cDNA descriptionRhesus FGF10 / KGF2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90087-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
VectorpCMV3-C-GFPSpark
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90087-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order