Products > Genes > Signaling > Signal Transduction(S)

Rhesus EphA4/Eph Receptor A4 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90039-ACG)

Overview

Product nameRhesus EphA4/Eph Receptor A4 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.CG90039-ACG
NCBI RefSeq2961 bp
TypeExpression-Ready ORF Clones
EPH receptor A4 (ephrin type-A receptor 4), also known as EphA4, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. EphA4 is enriched on dendritic spines of pyramidal neurons in the adult mouse hippocampus, and ephrin-A3 is localized on astrocytic processes that envelop spines. Eph receptor−mediated signaling, which is triggered by ephrins7, probably modifies the properties of synapses during synaptic activation and remodeling. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). The extracellular domain of an EphA4 interacts with ephrin ligands, which may be tethered to neighbouring cells. Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer.
Molecule nameEphA4
RefSeq ORF size2961 bp
cDNA descriptionRhesus EphA4/Eph Receptor A4 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90039-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
VectorpCMV3-C-GFPSpark
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90039-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order