Products > Genes > Signaling > Signal Transduction(S)

Rhesus Cadherin-12/CDH12 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag (CG90142-ACR)

Overview

Product nameRhesus Cadherin-12/CDH12 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag
Catalog No.CG90142-ACR
NCBI RefSeq2385 bp
TypeExpression-Ready ORF Clones
Classic Cadherins represent a family of calcium-dependent homophilic cell-cell adhesion molecules. They confer strong adhesiveness to animal cells when they are anchored to the actin cytoskeleton via their cytoplasmic binding partners, catenins. The cadherin/catenin adhesion system plays key roles in the morphogenesis and function of the vertebrate and invertebrate nervous systems. Furthermore, this system is involved in synaptic plasticity. Recent studies on the role of individual cadherin subtypes at synapses indicate that individual cadherin subtypes play their own unique role to regulate synaptic activities. Type II (atypical) cadherins are defined based on their lack of an HAV cell adhesion recognition sequence specific to type I cadherins. It has been observed that cells containing a specific cadherin subtype tend to cluster together to the exclusion of other types, both in cell culture and during development. Cadherin-12 also known as CDH12, is a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Cadherin-12 appears to be expressed specifically in the brain and its temporal pattern of expression would be consistent with a role during a critical period of neuronal development, perhaps specifically during synaptogenesis.
Molecule nameCDH12
RefSeq ORF size2385 bp
cDNA descriptionRhesus Cadherin-12/CDH12 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag (CG90142-ACR) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-OFPSpark Vector) to other plasmid vectors.
VectorpCMV3-C-OFPSpark
Tag SsequenceOFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90142-ACR below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order