Overview
Product name | Rhesus CD82/KAI-1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag |
---|
Catalog No. | CG90202-ACG |
---|
NCBI RefSeq | 801 bp |
---|
Type | Expression-Ready ORF Clones |
---|
Background
CD82, also known as KAI-1, structurally belongs to tetraspanin family while categorised as metastasis suppressor gene on functional grounds. KAI1/CD82 is localized on cell membrane and form interactions with other tetraspanins, integrins and chemokines which are respectively responsible for cell migration, adhesion and signalling. Downregulation of CD82 expression is associated with the advanced stages of many human cancers and correlates with the acquisition of metastatic potential. Recent studies sµggest that complex mechanisms underlie CD82 loss of function, including altered transcriptional regulation, splice variant production and post-translational protein modifications, and indicate a central role for CD82 in controlling metastasis as a 'molecular facilitator'. The loss of KAI1/CD82 expression in invasive and metastatic cancers is due to a complex, epigenetic mechanism that probably involves transcription factors such as NFkappaB, p53, and beta-catenin. A loss of KAI1 expression is also associated with the advanced stages of many human malignancies and results in the acquisition of invasive and metastatic capabilities by tumour cells. Thus, KAI1/CD82 is regarded as a wide-spectrum tumor metastasis suppressor.
Product information
Molecule name | CD82 |
---|
RefSeq ORF size | 801 bp |
---|
cDNA description | Rhesus CD82/KAI-1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90202-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors. |
---|
Vector | pCMV3-C-GFPSpark |
---|
Tag Ssequence | GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG |
---|
Sequencing primers | T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG) |
---|
Promoter | Enhanced CMV mammalian cell promoter |
---|
Antibiotic in E.coli | Kanamycin |
---|
Antibiotic in mammalian cell | Hygromycin |
---|
Shipping carrier | Each tube contains lyophilized plasmid. |
---|
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
---|
Inquire About This Product
Submit your question about CG90202-ACG below and we will get back to you within one business day.
Alternatively, call us at 888.754.5670.