Products > Genes > Other

Rhesus CD31/PECAM-1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90024-ACG)

Overview

Product nameRhesus CD31/PECAM-1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.CG90024-ACG
NCBI RefSeq2093 bp
TypeExpression-Ready ORF Clones
Molecule namePECAM1
RefSeq ORF size2093 bp
cDNA descriptionRhesus CD31/PECAM-1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90024-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
VectorpCMV3-C-GFPSpark
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90024-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order