Products > Genes > Cardiovascular > Angiogenesis

Rhesus BCMA/TNFRSF17/CD269 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90103-ACG)

Images(2)

GFP Gene Plasmid Map

Rhesus BCMA/TNFRSF17/CD269 Gene Expression validated Image

Overview

Product nameRhesus BCMA/TNFRSF17/CD269 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.CG90103-ACG
NCBI RefSeq552 bp
TypeExpression-Ready ORF Clones
Tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), also known as B cell maturation antigen (BCMA) or CD269 antigen, is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13BBAFF), and to lead to NF-kappaB and MAPK8/JNK activation. TNFRSF17/BCMA/CD269 also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. TNFRSF17/BCMA/CD269 is a receptor for TALL-1 and BCMA activates NF-kappaB throµgh a TRAF5-, TRAF6-, NIK-, and IKK-dependent pathway. The identification of TNFRSF17 as a NF-kappaB-activating receptor for TALL-1 sµggests molecular targets for drµg development against certain immunodeficient or autoimmune diseases. TNFRSF17/BCMA is a target of donor B-cell immunity in patients with myeloma who respond to DLI. Antibody responses to cell-surface BCMA may contribute directly to tumor rejection in vivo.
Molecule nameTNFRSF17
RefSeq ORF size552 bp
cDNA descriptionRhesus BCMA/TNFRSF17/CD269 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90103-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
VectorpCMV3-C-GFPSpark
PlasimidpCMV3-cynoTNFRSF17-GFPSpark
Restriction siteKpnI + XbaI (6kb + 1.28kb)
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence descriptionIdentical with the Gene Bank Ref. ID sequence except for the point mutations: 165 C/A not causing the amino acid variation. Please check the sequence information before order.
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

GFP Gene Plasmid Map

Rhesus BCMA/TNFRSF17/CD269 Gene Expression validated Image

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

Inquire About This Product

Submit your question about CG90103-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order