Products > Genes > Other

Rhesus BCA-1 / CXCL13 Gene ORF cDNA clone expression plasmid, C-His tag (CG90021-CH)

Overview

Product nameRhesus BCA-1 / CXCL13 Gene ORF cDNA clone expression plasmid, C-His tag
Catalog No.CG90021-CH
NCBI RefSeq330 bp
TypeExpression-Ready ORF Clones
Molecule nameCXCL13
RefSeq ORF size330 bp
cDNA descriptionRhesus BCA-1 / CXCL13 Gene ORF cDNA clone expression plasmid, C-His tag (CG90021-CH) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-His Vector) to other plasmid vectors.
VectorpCMV3-C-His
Tag SsequenceHis Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90021-CH below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order