Products > Genes > Neuroscience > Cell Adhesion Proteins

Rhesus ATP5F1 Gene ORF cDNA clone expression plasmid (CG90552-UT)

Overview

Product nameRhesus ATP5F1 Gene ORF cDNA clone expression plasmid
Catalog No.CG90552-UT
NCBI RefSeq771 bp
TypeExpression-Ready ORF Clones
Molecule nameATP5F1
RefSeq ORF size771 bp
cDNA descriptionRhesus ATP5F1 Gene ORF cDNA clone expression plasmid (CG90552-UT) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-untagged Vector) to other plasmid vectors.
VectorpCMV3-untagged
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliAmpicillin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90552-UT below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order