Products > Genes > Epigenetics > Apoptosis(E)

Human p27/Kip1/CDKN1B Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (HG11109-ACG)

Overview

Product nameHuman p27/Kip1/CDKN1B Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.HG11109-ACG
NCBI RefSeq597 bp
TypeExpression-Ready ORF Clones
Molecule nameCDKN1B
RefSeq ORF size597 bp
cDNA descriptionHuman p27/Kip1/CDKN1B Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (HG11109-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
SynonymCDKN4, KIP1, MEN1B, MEN4, P27KIP1
VectorpCMV3-C-GFPSpark
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about HG11109-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order