Products > Genes > Virus > Coronaviridae

Human TAB1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag (HG17460-ACR)

Overview

Product nameHuman TAB1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag
Catalog No.HG17460-ACR
NCBI RefSeq1515 bp
TypeExpression-Ready ORF Clones
Molecule nameTAB1
RefSeq ORF size1515 bp
cDNA descriptionHuman TAB1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag (HG17460-ACR) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-OFPSpark Vector) to other plasmid vectors.
Synonym3'-Tab1, MAP3K7IP1
VectorpCMV3-C-OFPSpark
Tag SsequenceOFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about HG17460-ACR below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order