Products > Genes > Cell Biology > Apoptosis(C)

Human SP1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag (HG12024-ACR)

Images(1)

GFP Gene Plasmid Map

Overview

Product nameHuman SP1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag
Catalog No.HG12024-ACR
NCBI RefSeq2358 bp
TypeExpression-Ready ORF Clones
Molecule nameSP1
RefSeq ORF size2358 bp
cDNA descriptionHuman SP1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag (HG12024-ACR) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-OFPSpark Vector) to other plasmid vectors.
VectorpCMV3-C-OFPSpark
PlasimidpCMV3-SP1-OFPSpark
Restriction siteKpnI + XbaI (6kb + 3.05kb)
Tag SsequenceOFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequence descriptionIdentical with the Gene Bank Ref. ID sequence.
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

GFP Gene Plasmid Map

Inquire About This Product

Submit your question about HG12024-ACR below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order