Products > Genes > Virus > Coronaviridae

Human NUDT4 Gene ORF cDNA clone expression plasmid, C-Flag tag (HG22975-CF)

Overview

Product nameHuman NUDT4 Gene ORF cDNA clone expression plasmid, C-Flag tag
Catalog No.HG22975-CF
NCBI RefSeq543 bp
TypeExpression-Ready ORF Clones
Molecule nameNUDT4
RefSeq ORF size543 bp
cDNA descriptionHuman NUDT4 Gene ORF cDNA clone expression plasmid, C-Flag tag (HG22975-CF) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-FLAG Vector) to other plasmid vectors.
SynonymDIPP2, DIPP2alpha, DIPP2beta, HDCMB47P
VectorpCMV3-C-FLAG
Tag SsequenceFLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
ApplicationStable or Transient mammalian expression
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about HG22975-CF below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order