Products > Genes > Cell Biology > Apoptosis(C)

Human Integrin alpha V/CD51/ITGAV Gene ORF cDNA clone expression plasmid (HG11269-UT)

Images(1)

GFP Gene Plasmid Map

Overview

Product nameHuman Integrin alpha V/CD51/ITGAV Gene ORF cDNA clone expression plasmid
Catalog No.HG11269-UT
NCBI RefSeq3147 bp
TypeExpression-Ready ORF Clones
Molecule nameITGAV
RefSeq ORF size3147 bp
cDNA descriptionHuman Integrin alpha V/CD51/ITGAV Gene ORF cDNA clone expression plasmid (HG11269-UT) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-untagged Vector) to other plasmid vectors.
SynonymCD51, MSK8, VNRA, VTNR
VectorpCMV3-untagged
PlasimidpCMV3-ITGAV
Restriction siteKpnI + XbaI (6.1kb + 3.15kb)
Sequence descriptionIdentical with the Gene Bank Ref. ID sequence except for the point mutations: 87 C>T not causing the amino acid variation., 2028 C>T not causing the amino acid variation.
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliAmpicillin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

GFP Gene Plasmid Map

Inquire About This Product

Submit your question about HG11269-UT below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order