Products > Genes > Microbiology > Pathogenic microorganism

Human ICAM-3 / CD50 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (HG10333-ACG)

Images(2)

Cynomolgus CD19/B4/CVID3 Gene Plasmid Map

CD50 Gene Expression validated Image

Overview

Product nameHuman ICAM-3 / CD50 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.HG10333-ACG
NCBI RefSeq1644 bp
TypeExpression-Ready ORF Clones
The protein ICAM-3, also known as CD50, is a member of the intercellular adhesion molecule (ICAM) family consisting three members. It is a DC-SIGN ligand that is constitutively expressed on resting leukocytes, and is thus an important molecule for the first immune response. ICAM-3 comprises of five immunoglobulin-like domains, and binds LFA-1 throµgh its two N-terminal domains. It functions not only as an adhesion molecule, but also as a potent signalling molecule. ICAM-3 binds to LFA-1 on antigen-presenting cells (APC) stabilizing the T cell-APC interaction, facilitating signaling throµgh the CD3/TCR complex. However, recent evidence using cultured and transformed T cells sµggests ICAM-3 may also function in signaling. It has been reported that CD50 molecule can play a role in developing functionally mature T lymphocytes and its expression increases during the maturation process of T lymphocytes. In addition, the interactions of ICAM-3 and LFA-1 facilitate HIV-1- induced virological synapse formation between T cells. ICAM-3 is associated with an increase of cellular radio-resistance and cancer cell proliferation. It could be considered as a candidate for anti-cancer drµg development and as a cancer diagnostic marker.
Molecule nameICAM3
RefSeq ORF size1644 bp
cDNA descriptionHuman ICAM-3 / CD50 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (HG10333-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
SynonymCD50, CDW50, ICAM-R
VectorpCMV3-C-GFPSpark
PlasimidpCMV3-ICAM3-GFPSpark
Restriction siteHindIII + XbaI (6kb + 2.37kb)
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence descriptionIdentical with the Gene Bank Ref. ID sequence.
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Cynomolgus CD19/B4/CVID3 Gene Plasmid Map

CD50 Gene Expression validated Image

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

Inquire About This Product

Submit your question about HG10333-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order