Products > Genes > Cell Biology > Apoptosis(C)

Human DcR3/TNFRSF6B transcript variant M68E Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (HG10224-ACG)

Images(2)

Cynomolgus CD19/B4/CVID3 Gene Plasmid Map

Human DcR3/TNFRSF6B Gene Expression validated Image

Overview

Product nameHuman DcR3/TNFRSF6B transcript variant M68E Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.HG10224-ACG
NCBI RefSeq903 bp
TypeExpression-Ready ORF Clones
Tumor necrosis factor receptor superfamily member 6B (TNFRSF6B) also known as DcR3(Decoy Receptor 3) and M68 is the tumor necrosis factor receptor superfamily. DcR3/TNFRSF6B belongs to the tumor necrosis factor receptor superfamily. The encoded protein is postulated to play a regulatory role in suppressing FasL- and LIGHT-mediated cell death. It acts as a decoy receptor that competes with death receptors for ligand binding. Over-expression of this gene has been noted in gastrointestinal tract tumors. Read-throµgh transcription into this gene from the neighboring upstream gene, which encodes regulator of telomere elongation helicase 1 (RTEL1), generates a non-coding transcript. DcR3/TNFRSF6B is detected in fetal lung, brain and liver. DcR3/TNFRSF6B is also detected in adult stomach, spinal cord, lymph node, trachea, spleen, colon and lung. This protein is highly expressed in several primary tumors from colon, stomach, rectum, esophagus and in SW480 colon carcinoma cells.
Molecule nameTNFRSF6B
RefSeq ORF size903 bp
cDNA descriptionHuman DcR3/TNFRSF6B transcript variant M68E Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (HG10224-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
SynonymDCR3, DJ583P15.1.1, M68, M68E, TNFRSF6B, TR6
VectorpCMV3-C-GFPSpark
PlasimidpCMV3-TNFRSF6B-GFPSpark
Restriction siteHindIII + XbaI (6kb + 1.63kb)
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence descriptionIdentical with the Gene Bank Ref. ID sequence except for the point mutations: 255 A>G not causing the amino acid variation.
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Cynomolgus CD19/B4/CVID3 Gene Plasmid Map

Human DcR3/TNFRSF6B Gene Expression validated Image

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

Inquire About This Product

Submit your question about HG10224-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order