Products > Genes > Microbiology > Pathogenic microorganism

Human Carboxypeptidase A1/CPA1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (HG10504-ACG)

Overview

Product nameHuman Carboxypeptidase A1/CPA1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.HG10504-ACG
NCBI RefSeq1260 bp
TypeExpression-Ready ORF Clones
Human Carboxypeptidase A1 (CPA1)is secreted as a pancreatic procarboxypeptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group, with the preference of  residues with aromatic or branched aliphatic side chains. CPA1 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. In contrast to procarboxypeptidase B which was always secreted by the pancreas as a monomer, procarboxypeptidase A occurs as a monomer and/or associated to one or two functionally different proteins, such as zymogen E, and is involved in zymogen inhibition. Three different forms of human pancreatic procarboxypeptidase A have been isolated.

Molecule nameCPA1
RefSeq ORF size1260 bp
cDNA descriptionHuman Carboxypeptidase A1/CPA1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (HG10504-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
SynonymCPA
VectorpCMV3-C-GFPSpark
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about HG10504-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order