Products > Genes > Developmental Biology > Embryogenesis

Human CD166/ALCAM Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (HG10045-ACG)

Images(2)

Cynomolgus CD19/B4/CVID3 Gene Plasmid Map

Human CD166/ALCAM Gene Expression validated Image

Overview

Product nameHuman CD166/ALCAM Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.HG10045-ACG
NCBI RefSeq1752 bp
TypeExpression-Ready ORF Clones
Activated leukocyte cell adhesion molecule (ALCAM)/Cluster of differentiation (CD166) is a type I transmembrane cell adhesion molecule belonging to the Ig superfamily and a ligand for CD6 that is expressed on T lymphocytes. The extracellular domain of ALCAM contains five Ig-like domains (three Ig-like C2-type domains and two Ig-like V-type domains), of which the amino-terminal V1 domain is essential for ligand binding and ALCAM-mediated cell aggregation. ALCAM mediates both heterophilic (ALCAM-CD6) and homophilic (ALCAM-ALCAM) cell-cell interactions. ALCAM/CD6 interaction plays a role in T cell development and T cell regulation, as well as in the binding of T- and B-cells to activated leukocytes. Recently, homophilic (ALCAM-ALCAM) adhesion was shown to play important roles in tight cell-to-cell interaction and regulation of stem cell differentiation. While expressed in a wide variety of tissues, ALCAM is usually restricted to subsets of cells involved in dynamic growth and/or migration, including neural development, branching organ development, hematopoiesis, immune response and tumor progression. And CD166 is regarded as a potential novel breast cancer indicator and therapeutic target.
Molecule nameALCAM
RefSeq ORF size1752 bp
cDNA descriptionHuman CD166/ALCAM Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (HG10045-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
SynonymCD166, MEMD
VectorpCMV3-C-GFPSpark
PlasimidpCMV3-ALCAM-GFPSpark
Restriction siteHindIII + XbaI (6kb + 2.48kb)
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence descriptionIdentical with the Gene Bank Ref. ID sequence.
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Cynomolgus CD19/B4/CVID3 Gene Plasmid Map

Human CD166/ALCAM Gene Expression validated Image

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

Inquire About This Product

Submit your question about HG10045-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order