Products > Genes > Other

Green fluorescent protein / GFP Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (AG13105-ACG)

Images(2)

GFP Gene Plasmid Map

GFP Gene Expression validated Image

Overview

Product nameGreen fluorescent protein / GFP Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.AG13105-ACG
NCBI RefSeq717 bp
TypeExpression-Ready ORF Clones
The green fluorescent protein (GFP) is a protein that exhibit bright green fluorescence when exposed to blue light. GFPSparkTM is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSparkTM is mainly intended for applications where fast appearance of bright fluorescence is crucial. Its amazing ability to generate a highly visible, efficiently emitting internal fluorophore is both intrinsically fascinating and tremendously valuable. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Molecule nameGFP
RefSeq ORF size717 bp
cDNA descriptionGreen fluorescent protein / GFP Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (AG13105-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
VectorpCMV3-C-GFPSpark
PlasimidpCMV3-GFP-GFPSpark
Restriction siteKpnI + XbaI (6kb + 1.45kb)
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence descriptionA number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAX31732.1.
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

GFP Gene Plasmid Map

GFP Gene Expression validated Image

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

Inquire About This Product

Submit your question about AG13105-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order