Products / Genes / Other

Cynomolgus p53 Gene ORF cDNA clone expression plasmid, N-OFPSpark tag

Summary
Catalog No:CG90001-ANR
NCBI RefSeq:1182 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Cynomolgus p53 Gene ORF cDNA clone expression plasmid, N-OFPSpark tag Product information

Molecule NameTP53
RefSeq ORF Size1182 bp
cDNA DescriptionCynomolgus p53 Gene ORF cDNA clone expression plasmid, N-OFPSpark tag (CG90001-ANR) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-N-OFPSpark Vector) to other plasmid vectors.
Synonymp53, TP53
VectorpCMV3-N-OFPSpark
Plasimid
Restriction site
Tag SequenceOFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90001-ANR below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed