Products > Genes > Other

Cynomolgus p53 Gene ORF cDNA clone expression plasmid, C-HA tag (CG90001-CY)

Overview

Product nameCynomolgus p53 Gene ORF cDNA clone expression plasmid, C-HA tag
Catalog No.CG90001-CY
NCBI RefSeq1182 bp
TypeExpression-Ready ORF Clones
Molecule nameTP53
RefSeq ORF size1182 bp
cDNA descriptionCynomolgus p53 Gene ORF cDNA clone expression plasmid, C-HA tag (CG90001-CY) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-HA Vector) to other plasmid vectors.
Synonymp53, TP53
VectorpCMV3-C-HA
Tag SsequenceHA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90001-CY below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order