Products > Genes > Neuroscience > Cell Adhesion Proteins

Cynomolgus Profilin 2 / PFN2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90562-ACG)

Overview

Product nameCynomolgus Profilin 2 / PFN2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.CG90562-ACG
NCBI RefSeq423 bp
TypeExpression-Ready ORF Clones
Profilin 2, also known as PFN2,  is a ubiquitous actin monomer-binding protein belonging to the profilin family. It is highly expressed in brain, skeletal muscle and kidney and less strongly in heart, placenta, lung and liver. Profilin 2 binds to actin and affects the structure of the cytoskeleton. At high concentrations, profilin prevents the polymerization of actin, whereas it enhances it at low concentrations. Profilin 2 is thoµght to regulate actin polymerization in response to extracellular signals. It inhibits the formation of IP3 and DG by binding to PIP2.

Molecule namePFN2
RefSeq ORF size423 bp
cDNA descriptionCynomolgus Profilin 2 / PFN2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90562-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
VectorpCMV3-C-GFPSpark
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90562-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order