Products > Genes > Cell Biology > Apoptosis(C)

Cynomolgus ICAP-1 Gene ORF cDNA clone expression plasmid, N-Flag tag (CG90438-NF)

Overview

Product nameCynomolgus ICAP-1 Gene ORF cDNA clone expression plasmid, N-Flag tag
Catalog No.CG90438-NF
NCBI RefSeq603 bp
TypeExpression-Ready ORF Clones
Molecule nameITGB1BP1
RefSeq ORF size603 bp
cDNA descriptionCynomolgus ICAP-1 Gene ORF cDNA clone expression plasmid, N-Flag tag (CG90438-NF) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-N-FLAG Vector) to other plasmid vectors.
VectorpCMV3-N-FLAG
Tag SsequenceFLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Inquire About This Product

Submit your question about CG90438-NF below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order