Products > Genes > Immunology > Adaptive Immunity

Cynomolgus FCRN/FCGRT Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90023-ACG)

Images(2)

GFP Gene Plasmid Map

Cynomolgus FCRN/FCGRT Gene Expression validated Image

Overview

Product nameCynomolgus FCRN/FCGRT Gene ORF cDNA clone expression plasmid, C-GFPSpark tag
Catalog No.CG90023-ACG
NCBI RefSeq1098 bp
TypeExpression-Ready ORF Clones
Molecule nameFCGRT
RefSeq ORF size1098 bp
cDNA descriptionCynomolgus FCRN/FCGRT Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90023-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
VectorpCMV3-C-GFPSpark
PlasimidpCMV3-cynoFCGRT-GFPSpark
Restriction siteKpnI + XbaI (6kb + 1.83kb)
Tag SsequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence descriptionIdentical with the Gene Bank Ref. ID sequence except for the point mutations: 120C/T, 543C/T, 576G/A, 1071T/C not causing the amino acid variation. Please check the sequence information before order.
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

GFP Gene Plasmid Map

Cynomolgus FCRN/FCGRT Gene Expression validated Image

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

Inquire About This Product

Submit your question about CG90023-ACG below and we will get back to you within one business day.

Alternatively, call us at 888.754.5670.

Select size and quantity
Contact us to order