Products / Genes / Signaling / Signal Transduction(S)

Rhesus aFGF/FGF1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:CG90062-ACG
NCBI RefSeq:468 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

aFGF, also known as FGF1 and HBGF-1, is a member of the fibroblast growth factor family. The biological activity of aFGF protein is exerted throµgh binding to four high affinity cell surface receptors (FGFR1–4), which results in receptor dimerization and transphosphorylation in the tyrosine kinase domain. aFGF protein shows a wide range of endocrine-like activities. As a multiple function growth factor, this protein is involved in embryo development and tissue repair. Additionally, this protein is considered to function in several important physiological and pathological processes, such as embryonic development, morphogenesis, angiogenesis, wound healing and atheromatosis, carcinogenesis, development, and invasion of cancer.

References

Rhesus aFGF/FGF1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NameFGF1
RefSeq ORF Size468 bp
cDNA DescriptionRhesus aFGF/FGF1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90062-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-GFPSpark
Plasimid
Restriction site
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90062-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed