Products / Genes / Cardiovascular / Angiogenesis

Rhesus TRAIL/TNFSF10 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:CG90098-ACG
NCBI RefSeq:846 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Tumor necrosis factor ligand superfamily member 10 (TNFSF10), also known as TNF-related apoptosis-inducing ligand (TRAIL), Apo-2 ligand, and CD253, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. TNFSF10 / Apo-2L / CD253 functions as a ligand that induces the process of cell death called apoptosis. TNFSF10 / TRAIL shows homology to other members of the tumor necrosis factor superfamily. As one member of the cluster of differentiation system, TNFSF10 / CD253 is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified throµgh the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell throµgh initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion TNFSF10 / Apo-2L / CD253 / TRAIL binds to several members of TNF receptor superfamily including TNFRSF10A / TRAILR1, TNFRSF10B / TRAILR2, TNFRSF10C / TRAILR3, TNFRSF10D / TRAILR4, and possibly also to TNFRSF11B/OPG. The activity of TNFSF10 / TRAIL may be modulated by binding to the decoy receptors TNFRSF10C / TRAILR3, TNFRSF10D/TRAILR4, and TNFRSF11B/OPG that cannot induce apoptosis. The binding of this protein to its receptors has been shown to trigger the activation of MAPK8 / JNK, caspase 8, and caspase 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Rhesus TRAIL/TNFSF10 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NameTNFSF10
RefSeq ORF Size846 bp
cDNA DescriptionRhesus TRAIL/TNFSF10 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90098-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-GFPSpark
Plasimid
Restriction site
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90098-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed