Products / Genes / Developmental Biology / Embryogenesis

Rhesus OMGP Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:CG90713-ACG
NCBI RefSeq:1323 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Mouse oligodendrocyte-myelin glycoprotein, also known as OMG and OMGP, is a cell membrane protein which contains eight LRR (leucine-rich) repeats. OMG / OMGP is a glycosylphosphatidylinositol-anchored protein expressed by neurons and oligodendrocytes in the central nervous system (CNS). OMG / OMGP is a cell adhesion molecule contributing to the interactive process required for myelination in the central nervous system. OMG / OMGP play roles in both the developing and adult central nervous system. OMG / OMGP participats in growth cone collapse and inhibition of neurite outgrowth throµgh its interaction with NgR, the receptor for Nogo. This function requires its leucine-rich repeat domain, a highly conserved region in OMgp during mammal evolution. OMG / OMGP leucine-rich repeat domain is also implicated in the inhibition of cell proliferation. OMG / OMGP may also be involved in the formation and maintenance of myelin sheaths. Cell proliferation, neuronal sprouting and myelination are crucial processes involved in brain development and regeneration after injury.

Rhesus OMGP Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NameOMG
RefSeq ORF Size1323 bp
cDNA DescriptionRhesus OMGP Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90713-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-GFPSpark
Plasimid
Restriction site
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90713-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed