Products / Genes / Cardiovascular / Angiogenesis

Rhesus Interferon alpha-B / IFNA8 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:CG90106-ACG
NCBI RefSeq:570 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Interferon alpha-B, also known as IFNA8, belongs to the alpha/beta interferon family. Interferons are proteins made and released by host cells in response to the presence of pathogens such as viruses,  bacteria,  parasites or tumorcells. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They also allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. Interferons also activate immune cells, such as natural killer cells and macrophages. They increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes. They also increase the ability of uninfected host cells to resist new infection by virus. Certain symptoms, such as aching muscles and fever, are related to the production of IFNs during infection. Produced by macrophages, IFN-alpha have antiviral activities.

Rhesus Interferon alpha-B / IFNA8 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NameIFNA8
RefSeq ORF Size570 bp
cDNA DescriptionRhesus Interferon alpha-B / IFNA8 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90106-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-GFPSpark
Plasimid
Restriction site
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90106-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed