Products / Genes / Cancer / Cancer immunology

Rhesus IL-1R2/CD121b Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:CG90120-ACG
NCBI RefSeq:1185 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Interleukin 1 receptor, type II (IL1R2) also known as CD121b (Cluster of Differentiation 121b) is a cytokine receptor that belongs to the interleukin-1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I (IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. The pleiotropic cytokine IL1 is produced to regulate development and maintenance of the inflammatory responses, and binds to specific plasma membrane receptors on cells. Two distinct types of IL1 receptors which are able to bind IL1 specifically have been identified, designated as IL1RI (IL1RA) and IL1RII (IL1RB). IL1R1 contributes to IL-1 signaling, whereas the IL-1R2/CD121b has no signaling property and acts as a decoy for IL-1. IL-1R2/CD121b structurally consisting of a ligand binding portion comprised of three Ig-like domains, a single transmembrane region, and a short cytoplasmic domain, is expressed in a variety of cell types including B lymphocytes, neutrophils, monocytes, large granular leukocytes and endothelial cells. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine.

Rhesus IL-1R2/CD121b Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NameIL1R2
RefSeq ORF Size1185 bp
cDNA DescriptionRhesus IL-1R2/CD121b Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90120-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-GFPSpark
Plasimid
Restriction site
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90120-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed