Products / Genes / Cardiovascular / Angiogenesis

Rhesus FGF7 / FGF-7 / KGF Gene ORF cDNA clone expression plasmid, C-His tag

Summary
Catalog No:CG90071-CH
NCBI RefSeq:585 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Rhesus FGF7 / FGF-7 / KGF Gene ORF cDNA clone expression plasmid, C-His tag Product information

Molecule NameFGF7
RefSeq ORF Size585 bp
cDNA DescriptionRhesus FGF7 / FGF-7 / KGF Gene ORF cDNA clone expression plasmid, C-His tag (CG90071-CH) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-His Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-His
Plasimid
Restriction site
Tag SequenceHis Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90071-CH below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed