Products / Genes / Microbiology / Pathogenic microorganism

Rhesus DPP4 / CD26 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:CG90180-ACG
NCBI RefSeq:2301 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Dipeptidyl peptidase-4 (DPP4) or adenosine deaminase complexing protein 2 (ADCP 2) or T-cell activation antigen CD26 is a serine exopeptidase belonging to the S9B protein family that cleaves X-proline dipeptides from the N-terminus of polypeptides, such as chemokines, neuropeptides, and peptide hormones. The enzyme is a type II transmembrane glycoprotein, expressed on the surface of many cell types. It is also present in serum and other body fluids in a truncated form (sCD26/DPPIV). The soluble CD26 (sCD26) as a tumour marker for the detection of colorectal cancer (CRC) and advanced adenomas. As both a regulatory enzyme and a signalling factor, DPP4 has been evaluated and described in many studies. DPP4 inhibition results in increased blood concentration of the incretin hormones glucagon-like peptide-1 (GLP-1) and gastric inhibitory polypeptide (GIP). This causes an increase in glucose-dependent stimulation, resulting in a lowering of blood glucose levels. Recent studies have shown that DPP4 inhibitors can induce a significant reduction in glycosylated haemoglobin (HbA(1c)) levels, either as monotherapy or as a combination with other antidiabetic agents. Research has also demonstrated that DPP4 inhibitors portray a very low risk of hypoglycaemia development, and are a new pharmacological class of drµgs for treating Type 2 diabetes.

Rhesus DPP4 / CD26 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NameDPP4
RefSeq ORF Size2301 bp
cDNA DescriptionRhesus DPP4 / CD26 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90180-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-GFPSpark
Plasimid
Restriction site
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90180-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed