Products / Genes / Signaling / Signal Transduction(S)

Rhesus CDH13 / Cadherin-13 / H Cadherin Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:CG90141-ACG
NCBI RefSeq:2142 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

CDH13, also known as cadherin-13 and H Cadherin, is a member of the cadherin superfamily. CDH13 acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. CDH13 is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. CDH13 gene is hypermethylated in many types of cancer.

Rhesus CDH13 / Cadherin-13 / H Cadherin Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NameCDH13
RefSeq ORF Size2142 bp
cDNA DescriptionRhesus CDH13 / Cadherin-13 / H Cadherin Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90141-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-GFPSpark
Plasimid
Restriction site
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90141-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed