Products / Genes / Developmental Biology / Embryogenesis

Rhesus CD31/PECAM-1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag

Summary
Catalog No:CG90024-ACR
NCBI RefSeq:2093 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

The Cluster of Differentiation 31 (CD31) adhesion molecule, also known as platelet-endothelial cell adhesion molecule-1 (PECAM-1), is the only known member of the CAM family on platelets. CD31 protein is a 130-kDa transmembrane glycoprotein expressed by endothelial cells, platelets, monocytes, neutrophils, and certain T cell subsets. CD31 protein is also expressed in certain tumors, including epithelioid hemangioendothelioma, other vascular tumors, and histiocytic malignancies. CD31 plays a key role in removing aged neutrophils and tissue regeneration. CD31 protein mediates the homotypic or heterotypic cell adhesion by binding to itself or the leukocyte integrin αvβ3, and thus plays a role in neutrophil recruitment in inflammatory responses, transendothelial migration of leukocytes, as well as in cardiovascular development.

Rhesus CD31/PECAM-1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag Product information

Molecule NamePECAM1
RefSeq ORF Size2093 bp
cDNA DescriptionRhesus CD31/PECAM-1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag (CG90024-ACR) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-OFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-OFPSpark
Plasimid
Restriction site
Tag SequenceOFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90024-ACR below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed