Products / Genes / Developmental Biology / Embryogenesis

Rhesus CD166/ALCAM Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:CG90227-ACG
NCBI RefSeq:1752 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Activated leukocyte cell adhesion molecule (ALCAM)/Cluster of differentiation (CD166) is a type I transmembrane cell adhesion molecule belonging to the Ig superfamily and a ligand for CD6 that is expressed on T lymphocytes. The extracellular domain of ALCAM contains five Ig-like domains (three Ig-like C2-type domains and two Ig-like V-type domains), of which the amino-terminal V1 domain is essential for ligand binding and ALCAM-mediated cell aggregation. ALCAM mediates both heterophilic (ALCAM-CD6) and homophilic (ALCAM-ALCAM) cell-cell interactions. ALCAM/CD6 interaction plays a role in T cell development and T cell regulation, as well as in the binding of T- and B-cells to activated leukocytes. Recently, homophilic (ALCAM-ALCAM) adhesion was shown to play important roles in tight cell-to-cell interaction and regulation of stem cell differentiation. While expressed in a wide variety of tissues, ALCAM is usually restricted to subsets of cells involved in dynamic growth and/or migration, including neural development, branching organ development, hematopoiesis, immune response and tumor progression. And CD166 is regarded as a potential novel breast cancer indicator and therapeutic target.

Rhesus CD166/ALCAM Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NameALCAM
RefSeq ORF Size1752 bp
cDNA DescriptionRhesus CD166/ALCAM Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90227-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-GFPSpark
Plasimid
Restriction site
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90227-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed