Products / Genes / Cardiovascular / Angiogenesis

Rhesus ALK-7 / ACVR1C Gene ORF cDNA clone expression plasmid, N-Myc tag

Summary
Catalog No:CG90067-NM
NCBI RefSeq:1482 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

ALK-7, also known as ALK7 and ACVR1C, belongs to the ALK family. It is a type I receptor for the TGFB family of signaling molecules. TGF-β is the prototype of a protein superfamily which, in humans, contains at least 35 members, including activins, inhibins, bone morphogenetic proteins, growth/differentiation factors, and Müllerian inhibiting substance. ALK-7 is a serine-threonine kinase that can cause the activation of one of the SMAD signal transducers, SMAD2. ALK-7 has a ligand known as Nodal. Nodal stimulates the secretion of TIMP-1 and inhibits matrix metalloproteinases MMP-2 and MMP-9 activity. The overexpression of Nodal or constitutively active ALK-7 decreases cell migration and invasion, whereas knock-down of Nodal and ALK-7 has the opposite effects.

Rhesus ALK-7 / ACVR1C Gene ORF cDNA clone expression plasmid, N-Myc tag Product information

Molecule NameACVR1C
RefSeq ORF Size1482 bp
cDNA DescriptionRhesus ALK-7 / ACVR1C Gene ORF cDNA clone expression plasmid, N-Myc tag (CG90067-NM) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-SP-N-Myc Vector) to other plasmid vectors.
Synonym
VectorpCMV3-SP-N-Myc
Plasimid
Restriction site
Tag SequenceMyc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90067-NM below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed