Products / Genes / Microbiology / Pathogenic microorganism

Rhesus ACE2 / Angiotensin-Converting Enzyme 2 Gene ORF cDNA clone expression plasmid, C-His tag

Summary
Catalog No:CG90211-CH
NCBI RefSeq:2418 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS) by counterbalancing ACE activity. Accumulating evidence in recent years has demonstrated a physiological and pathological role of ACE2 in the cardiovascular, renal and respiratory systems. ACE2 also has an important role in blood pressure control. This enzyme, an homolog of ACE, hydrolyzes angiotensin (Ang) I to produce Ang-(1-9), which is subsequently converted into Ang-(1-7) by a neutral endopeptidase and ACE. ACE2 releases Ang-(1-7) more efficiently than its catalysis of Ang-(1-9) by cleavage of Pro(7)-Phe(8) bound in Ang II. Thus, the major biologically active product of ACE2 is Ang-(1-7), which is considered to be a beneficial peptide of the RAS cascade in the cardiovascular system. A physiological role for ACE2 has been implicated in hypertension, cardiac function, heart function and diabetes, and as a receptor of the severe acute respiratory syndrome coronavirus. In the acute respiratory distress syndrome (ARDS), ACE, AngII, and AT1R promote the disease pathogenesis, whereas ACE2 and the AT2R protect from ARDS. Importantly, ACE2 has been identified as a key SARS-coronavirus receptor and plays a protective role in severe acute respiratory syndrome (SARS) pathogenesis. Furthermore, the recent explosion of research into the ACE2 homolog, collectrin, has revealed a new physiological function of ACE2 as an amino acid transporter, which explains the pathogenic role of gene mutations in Hartnup disorder. This review summarizes and discusses the recently unveiled roles for ACE2 in disease pathogenesis.

Rhesus ACE2 / Angiotensin-Converting Enzyme 2 Gene ORF cDNA clone expression plasmid, C-His tag Product information

Molecule NameACE2
RefSeq ORF Size2418 bp
cDNA DescriptionRhesus ACE2 / Angiotensin-Converting Enzyme 2 Gene ORF cDNA clone expression plasmid, C-His tag (CG90211-CH) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-His Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-His
Plasimid
Restriction site
Tag SequenceHis Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90211-CH below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed