Products / Genes / Virus / Coronaviridae

MERS CoV Plpro ORF mammalian expression plasmid, N-OFPSpark / RFP tag

Summary
Catalog No:VG40522-ANR
NCBI RefSeq:1140 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

MERS CoV Plpro ORF mammalian expression plasmid, N-OFPSpark / RFP tag Product information

Molecule NamePLpro
RefSeq ORF Size1140 bp
cDNA DescriptionMERS CoV Plpro ORF mammalian expression plasmid, N-OFPSpark / RFP tag (VG40522-ANR) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-N-OFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-N-OFPSpark
Plasimid
Restriction site
Tag SequenceOFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on VG40522-ANR below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed