Products / Genes / Virus / Coronaviridae

Human TAB1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag

Summary
Catalog No:HG17460-ACR
NCBI RefSeq:1515 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Human TAB1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag Product information

Molecule NameTAB1
RefSeq ORF Size1515 bp
cDNA DescriptionHuman TAB1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag (HG17460-ACR) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-OFPSpark Vector) to other plasmid vectors.
Synonym3'-Tab1, MAP3K7IP1
VectorpCMV3-C-OFPSpark
Plasimid
Restriction site
Tag SequenceOFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on HG17460-ACR below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed