Products / Genes / Cell Biology / Apoptosis(C)

Human SP1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag

Summary
Catalog No:HG12024-ACR
NCBI RefSeq:2358 bp
Type:Expression-Ready ORF Clones
Gene ID:
Images(1)

GFP Gene Plasmid Map

To buy,select size,quantity

Background

Human SP1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag Product information

Molecule NameSP1
RefSeq ORF Size2358 bp
cDNA DescriptionHuman SP1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag (HG12024-ACR) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-OFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-OFPSpark
PlasimidpCMV3-SP1-OFPSpark
Restriction siteKpnI + XbaI (6kb + 3.05kb)
Tag SequenceOFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequence DescriptionIdentical with the Gene Bank Ref. ID sequence.
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Human SP1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag images

GFP Gene Plasmid Map

Neucleotide sequence and amino acid sequence

Yellow:linker
Green:OFP tag
 
ATGAGCGACCAAGATCACTCCATGGATGAAATGACAGCTGTGGTGAAAATTGAAAAAGGAGTTGGTGGCAATAATGGGGGCAATGGTAATGGTGGTGGTGCCTTTTCACAGGCTCGAAGTAGCAGCACAGGCAGTAGCAGCAGCACTGGAGGAGGAGGGCAGGAGTCCCAGCCATCCCCTTTGGCTCTGCTGGCAGCAACTTGCAGCAGAATTGAGTCACCCAATGAGAACAGCAACAACTCCCAGGGCCCGAGTCAGTCAGGGGGAACAGGTGAGCTTGACCTCACAGCCACACAACTTTCACAGGGTGCCAATGGCTGGCAGATCATCTCTTCCTCCTCTGGGGCTACCCCTACCTCAAAGGAACAGAGTGGCAGCAGTACCAATGGCAGCAATGGCAGTGAGTCTTCCAAGAATCGCACAGTCTCTGGTGGGCAGTATGTTGTGGCTGCCGCTCCCAACTTACAGAACCAGCAAGTTCTGACAGGACTACCTGGAGTGATGCCTAATATTCAGTATCAAGTAATCCCACAGTTCCAGACCGTTGATGGGCAACAGCTGCAGTTTGCTGCCACTGGGGCCCAAGTGCAGCAGGATGGTTCTGGTCAAATACAGATCATACCAGGTGCAAACCAACAGATTATCACAAATCGAGGAAGTGGAGGCAACATCATTGCTGCTATGCCAAACCTACTCCAGCAGGCTGTCCCCCTCCAAGGCCTGGCTAATAATGTACTCTCAGGACAGACTCAGTATGTGACCAATGTACCAGTGGCCCTGAATGGGAACATCACCTTGCTACCTGTCAACAGCGTTTCTGCAGCTACCTTGACTCCCAGCTCTCAGGCAGTCACGATCAGCAGCTCTGGGTCCCAGGAGAGTGGCTCACAGCCTGTCACCTCAGGGACTACCATCAGTTCTGCCAGCTTGGTATCATCACAAGCCAGTTCCAGCTCCTTTTTCACCAATGCCAATAGCTACTCAACTACTACTACCACCAGCAACATGGGAATTATGAACTTTACTACCAGTGGATCATCAGGGACCAACTCTCAAGGCCAGACACCCCAGAGGGTCAGTGGGCTACAGGGGTCTGATGCTCTGAACATCCAGCAAAACCAGACATCTGGAGGCTCATTGCAAGCAGGCCAGCAAAAAGAAGGAGAGCAAAACCAGCAGACACAGCAGCAACAAATTCTTATCCAGCCTCAGCTAGTTCAAGGGGGACAGGCCCTCCAGGCCCTCCAAGCAGCACCATTGTCAGGGCAGACCTTTACAACTCAAGCCATCTCCCAGGAAACCCTCCAGAACCTCCAGCTTCAGGCTGTTCCAAACTCTGGTCCCATCATCATCCGGACACCAACAGTGGGGCCCAATGGACAGGTCAGTTGGCAGACTCTACAGCTGCAGAACCTCCAAGTTCAGAACCCACAAGCCCAAACAATCACCTTAGCCCCAATGCAGGGTGTTTCCTTGGGGCAGACCAGCAGCAGCAACACCACTCTCACACCCATTGCCTCAGCTGCTTCCATTCCTGCTGGCACAGTCACTGTGAATGCTGCTCAACTCTCCTCCATGCCAGGCCTCCAGACCATTAACCTCAGTGCATTGGGTACTTCAGGAATCCAGGTGCACCCAATTCAAGGCCTGCCGTTGGCTATAGCAAATGCCCCAGGTGATCATGGAGCTCAGCTTGGTCTCCATGGGGCTGGTGGTGATGGAATACATGATGACACAGCAGGTGGAGAGGAAGGAGAAAACAGCCCAGATGCCCAACCCCAAGCCGGTCGGAGGACCCGGCGGGAAGCATGCACCTGCCCCTACTGTAAAGACAGTGAAGGAAGGGGCTCGGGGGATCCTGGCAAAAAGAAACAGCATATTTGCCACATCCAAGGCTGTGGGAAAGTGTATGGCAAGACCTCTCACCTGCGGGCACACTTGCGCTGGCATACAGGCGAGAGGCCATTTATGTGTACCTGGTCATACTGTGGGAAACGCTTCACACGTTCGGATGAGCTACAGAGGCACAAACGTACACACACAGGTGAGAAGAAATTTGCCTGCCCTGAGTGTCCTAAGCGCTTCATGAGGAGTGACCACCTGTCAAAACATATCAAGACCCACCAGAATAAGAAGGGAGGCCCAGGTGTAGCTCTGAGTGTGGGCACTTTGCCCCTGGACAGTGGGGCAGGTTCAGAAGGCAGTGGCACTGCCACTCCTTCAGCCCTTATTACCACCAATATGGTAGCCATGGAGGCCATCTGTCCAGAGGGCATTGCCCGTCTTGCCAACAGTGGCATCAACGTCATGCAGGTGGCAGATCTGCAGTCCATTAATATCAGTGGCAATGGCTTCGGGGGTGGAGGCTCTGATAGCACTGAGAACGTCATCAAGCCCTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGTGGGCGAGGGCCGCCCCTACGAGGGCTTTCAGACCGCTAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCATTTCACCTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTACGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTACAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGTGCCCTGAAGGGCAAGATCAAGATGAGGCTGAAGCTGAAGGACGGCGGCCACTACACCTCCGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACATCGTCGACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACCACCTGTTCCAGTAA
 
MSDQDHSMDEMTAVVKIEKGVGGNNGGNGNGGGAFSQARSSSTGSSSSTGGGGQESQPSPLALLAATCSRIESPNENSNNSQGPSQSGGTGELDLTATQLSQGANGWQIISSSSGATPTSKEQSGSSTNGSNGSESSKNRTVSGGQYVVAAAPNLQNQQVLTGLPGVMPNIQYQVIPQFQTVDGQQLQFAATGAQVQQDGSGQIQIIPGANQQIITNRGSGGNIIAAMPNLLQQAVPLQGLANNVLSGQTQYVTNVPVALNGNITLLPVNSVSAATLTPSSQAVTISSSGSQESGSQPVTSGTTISSASLVSSQASSSSFFTNANSYSTTTTTSNMGIMNFTTSGSSGTNSQGQTPQRVSGLQGSDALNIQQNQTSGGSLQAGQQKEGEQNQQTQQQQILIQPQLVQGGQALQALQAAPLSGQTFTTQAISQETLQNLQLQAVPNSGPIIIRTPTVGPNGQVSWQTLQLQNLQVQNPQAQTITLAPMQGVSLGQTSSSNTTLTPIASAASIPAGTVTVNAAQLSSMPGLQTINLSALGTSGIQVHPIQGLPLAIANAPGDHGAQLGLHGAGGDGIHDDTAGGEEGENSPDAQPQAGRRTRREACTCPYCKDSEGRGSGDPGKKKQHICHIQGCGKVYGKTSHLRAHLRWHTGERPFMCTWSYCGKRFTRSDELQRHKRTHTGEKKFACPECPKRFMRSDHLSKHIKTHQNKKGGPGVALSVGTLPLDSGAGSEGSGTATPSALITTNMVAMEAICPEGIARLANSGINVMQVADLQSINISGNGFGGGGSDSTENVIKPFMRFKVHMEGSVNGHEFEIEGVGEGRPYEGFQTAKLKVTKGGPLPFAWDILSPHFTYGSKAYVKHPADIPDYLKLSFPEGFKWERVMNYEDGGVVTVTQDSSLQDGEFIYKVKLRGTNFPSDGPVMQKKTMGWEASSERMYPEDGALKGKIKMRLKLKDGGHYTSEVKTTYKAKKPVQLPGAYIVDIKLDITSHNEDYTIVEQYERAEGRHHLFQ-

Ask Us About This Product

submit your question on HG12024-ACR below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed