Products / Genes / Cell Biology / Apoptosis(C)

Human SP1 Gene ORF cDNA clone expression plasmid, C-Myc tag

Summary
Catalog No:HG12024-CM
NCBI RefSeq:2358 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Human SP1 Gene ORF cDNA clone expression plasmid, C-Myc tag Product information

Molecule NameSP1
RefSeq ORF Size2358 bp
cDNA DescriptionHuman SP1 Gene ORF cDNA clone expression plasmid, C-Myc tag (HG12024-CM) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-Myc Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-Myc
Plasimid
Restriction site
Tag SequenceMyc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on HG12024-CM below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed