Products / Genes / Epigenetics / Apoptosis(E)

Human PPM1B Gene ORF cDNA clone expression plasmid, C-His tag

Summary
Catalog No:HG12224-CH
NCBI RefSeq:579 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Human PPM1B Gene ORF cDNA clone expression plasmid, C-His tag Product information

Molecule NamePPM1B
RefSeq ORF Size579 bp
cDNA DescriptionHuman PPM1B Gene ORF cDNA clone expression plasmid, C-His tag (HG12224-CH) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-His Vector) to other plasmid vectors.
SynonymPP2C-beta, PP2C-beta-X, PP2CB, PP2CBETA, PPC2BETAX
VectorpCMV3-C-His
Plasimid
Restriction site
Tag SequenceHis Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on HG12224-CH below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed