Products / Genes / Cancer / Cancer immunology

Human IL-1R9/IL1RAPL2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:HG10156-ACG
NCBI RefSeq:2061 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

X-linked interleukin-1 receptor accessory protein-like 2 (IL1RAPL2) or Interleukin-1 receptor 9 (IL-1R9) is a member of the interleukin 1 receptor family. This protein is similar to the interleukin 1 accessory proteins. IL-1R9/IL1RAPL2 shows restricted expression in fetal brain and is highly homologous to IL1RAPL, which is reportedly involved in nonsyndromic X-linked mental retardation. IL-1R9/IL1RAPL2 is highly homologous to IL-1R8. Both forms have no known ligands and receptor are found in the fetal brain. IL-1R9/IL1RAPL2 may function as a negative receptor. Both IL1RAPL1 and IL1RAPL2 have novel C-terminal sequences not present in other related proteins. IL-1R9/IL1RAPL2 may be strong candidates for X-linked non-syndromic mental retardation loci, and that molecules resembling IL-1 and IL-18 play a role in the development or function of the central nervous system.

Human IL-1R9/IL1RAPL2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NameIL1RAPL2
RefSeq ORF Size2061 bp
cDNA DescriptionHuman IL-1R9/IL1RAPL2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (HG10156-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
SynonymIL-1R9, IL1R9, IL1RAPL-2, TIGIRR-1
VectorpCMV3-C-GFPSpark
Plasimid
Restriction site
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on HG10156-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed